Pharma Excipients
No Result
View All Result
  • Login
  • Shop
  • News
    • Specials
      • Excipients for CBD
      • Excipients & 3D Printing
      • Infographics – The overview
      • GMP-certified excipient production sites
      • The Future of TiO2
      • Excipients in the COVID-19 Vaccines
      • BASF PVP-Iodine
      • RegXcellence™
      • BASF Parenteral Excipients
    • World Days – The overview
  • Excipient basics
    • Excipient Solutions for CBD
    • Inorganic Chemicals
      • Calcium Carbonate
      • Calcium Phosphates
      • Calcium Sulfate
      • Halites
      • Metallic Oxides
      • Silica
    • Organic Chemicals
      • Actual Sugars
      • Artificial Sweeteners
      • Carbohydrates
      • Cellulose
      • Cellulose Esters
      • Cellulose Ethers
      • CMC and Croscarmellose Sodium
      • Converted Starch
      • Dried Starch
      • Microcrystalline Cellulose
      • Modified Starch
      • Starch
      • Sugars
      • Sugar Alcohols
    • Petrochemicals
      • Acrylic Polymers
      • Glycols
      • Mineral Hydrocarbons
      • Mineral Oils
      • Mineral Waxes
      • Petrolatum
      • Polyethylene Glycol (PEG)
      • Povidones
      • Propylene Glycol
      • Other Petrochemical Excipients
    • Oleochemicals
      • Fatty Alcohols
      • Glycerin
      • Mineral Stearates
      • Pharmaceutical Oils
      • Other Oleochemical Excipients
    • Proteins
  • Applications
    • 3D Printing – Drug Carrier
      • 3D Printing
      • Binder
      • Coating
      • Colour / Color
      • Coating Systems and Additives
      • Controlled Release Excipient
      • DC excipient
      • Disintegrant / Superdisintergrant
      • Drug Carrier
    • Emulsifier – Glidant
      • Emulsifier
      • Excipient for Inhalation
      • Filler
      • Film former
      • Flavour / Flavor
      • Glidant
    • Lubricant – Preservative
      • Lubricant
      • Nanotechnology
      • Orally Dissolving Technology Excipient
      • Pellet
      • Plasticizer
      • Preservative
    • Solubilizer – Viscocity Agent
      • Solubilizer
      • Speciality Excipient
      • Surfactants
      • Suspension Agent
      • Sustained Release Agent
      • Sweeteners
      • Taste Masking
      • Topical Excipient
      • Viscocity Agent
  • Sources
    • Handbook of Pharmaceutical Excipients – 9th Edition
    • EINECS Numbers
    • Excipient DMF List
    • Excipient cGMP Certification Organisations
    • FDA Inactive Ingredient List
    • FDA GRAS Substances (SCOGS) Database
    • Excipient E-Numbers
    • Whitepapers / Publications
    • Contract Development|Contract Manufacturing
  • Suppliers
    Excipient Suppliers List
    BIOGRUND Logo
    Evonik Logo
    LI logo violet
    logo roquette
    ADM
    Armor Pharma
    Asahi KASEI
    Ashland
    BASF
    Beneo
    Captisol
    Clariant Logo
    Clariant
    Croda
    DFE Pharma
    Excipio Chemicals
    Fuji Chemical
    Gattefossé
    Gangwal
    IamFluidics
    IamFluidics
    IOI Oleo
    Ingredient Pharm
    JRS Pharma
    Kerry Logo
    Kerry
    KLK Oleo
    KLK Oleo
    Lipoid
    Lubrizol Life Science Health
    Lubrizol Life Science Health
    MAGNESIA
    MAGNESIA
    MEGGLE Excipients & Technology
    MEGGLE
    Nagase Viita
    Nagase Viita
    Nordic Bioproducts
    Nordic Bioproducts
    Pfanstiehl
    Pfanstiehl
    pharm-a-spheres
    pharm-a-spheres
    PMC Isochem
    PMC Isochem
    Seppic
    Seppic
    ShinEtsu
    ShinEtsu
    Sigachi
    Sigachi
    SPI Pharma
    SPI Pharma
    Südzucker
    Südzucker
    Vikram Thermo
    Vikram Thermo
    Zerion Pharma
    Zerion Pharma
    • A-B
      • ADM
      • ARMOR PHARMA
      • Ceolus™ & Celphere™
      • Ashland
      • BASF
      • Beneo – galenIQ
      • Biogrund
      • Budenheim
    • C-G
      • Captisol
      • Croda
      • Cyclolab
      • DFE Pharma
      • DuPont Pharma Solutions
      • Evonik
      • Fuji Chemical Industries
      • Gattefossé
      • Gangwal Healthcare
    • I-O
      • ingredientpharm
      • IOI Oleochemical
      • JRS Pharma
      • Kerry
      • KLK Oleo Life Science
      • Lactalis Ingredients Pharma
      • Lipoid
      • Dr. Paul Lohmann
      • Lubrizol
      • Magnesia
      • MEGGLE Excipients
      • Nagase Viita – Pharmaceutical Ingredients
      • Nordic Bioproducts Group
    • P-Z
      • Pfanstiehl
      • pharm-a-spheres
      • Pharma Line
      • PMC Isochem
      • Roquette Pharma
      • Seppic
      • Shin-Etsu
      • Sigachi Group
      • Südzucker AG
      • VIKRAM THERMO
      • Zerion Pharma
      • ZoomLab® – Your Virtual Pharma Assistant
  • Inquiries
    • Product Inquiry
    • Tailored Tableting Excipients
      • Tailored Film Coating
  • Events
    • Overview Pharmaceutical Webinars
    • Videos CPhI Frankfurt 2025
    • CPhI China 2024
    • ExciPerience – The great excipient event!
  • All4Nutra

No products in the cart.

  • Shop
  • News
    • Specials
      • Excipients for CBD
      • Excipients & 3D Printing
      • Infographics – The overview
      • GMP-certified excipient production sites
      • The Future of TiO2
      • Excipients in the COVID-19 Vaccines
      • BASF PVP-Iodine
      • RegXcellence™
      • BASF Parenteral Excipients
    • World Days – The overview
  • Excipient basics
    • Excipient Solutions for CBD
    • Inorganic Chemicals
      • Calcium Carbonate
      • Calcium Phosphates
      • Calcium Sulfate
      • Halites
      • Metallic Oxides
      • Silica
    • Organic Chemicals
      • Actual Sugars
      • Artificial Sweeteners
      • Carbohydrates
      • Cellulose
      • Cellulose Esters
      • Cellulose Ethers
      • CMC and Croscarmellose Sodium
      • Converted Starch
      • Dried Starch
      • Microcrystalline Cellulose
      • Modified Starch
      • Starch
      • Sugars
      • Sugar Alcohols
    • Petrochemicals
      • Acrylic Polymers
      • Glycols
      • Mineral Hydrocarbons
      • Mineral Oils
      • Mineral Waxes
      • Petrolatum
      • Polyethylene Glycol (PEG)
      • Povidones
      • Propylene Glycol
      • Other Petrochemical Excipients
    • Oleochemicals
      • Fatty Alcohols
      • Glycerin
      • Mineral Stearates
      • Pharmaceutical Oils
      • Other Oleochemical Excipients
    • Proteins
  • Applications
    • 3D Printing – Drug Carrier
      • 3D Printing
      • Binder
      • Coating
      • Colour / Color
      • Coating Systems and Additives
      • Controlled Release Excipient
      • DC excipient
      • Disintegrant / Superdisintergrant
      • Drug Carrier
    • Emulsifier – Glidant
      • Emulsifier
      • Excipient for Inhalation
      • Filler
      • Film former
      • Flavour / Flavor
      • Glidant
    • Lubricant – Preservative
      • Lubricant
      • Nanotechnology
      • Orally Dissolving Technology Excipient
      • Pellet
      • Plasticizer
      • Preservative
    • Solubilizer – Viscocity Agent
      • Solubilizer
      • Speciality Excipient
      • Surfactants
      • Suspension Agent
      • Sustained Release Agent
      • Sweeteners
      • Taste Masking
      • Topical Excipient
      • Viscocity Agent
  • Sources
    • Handbook of Pharmaceutical Excipients – 9th Edition
    • EINECS Numbers
    • Excipient DMF List
    • Excipient cGMP Certification Organisations
    • FDA Inactive Ingredient List
    • FDA GRAS Substances (SCOGS) Database
    • Excipient E-Numbers
    • Whitepapers / Publications
    • Contract Development|Contract Manufacturing
  • Suppliers
    Excipient Suppliers List
    BIOGRUND Logo
    Evonik Logo
    LI logo violet
    logo roquette
    ADM
    Armor Pharma
    Asahi KASEI
    Ashland
    BASF
    Beneo
    Captisol
    Clariant Logo
    Clariant
    Croda
    DFE Pharma
    Excipio Chemicals
    Fuji Chemical
    Gattefossé
    Gangwal
    IamFluidics
    IamFluidics
    IOI Oleo
    Ingredient Pharm
    JRS Pharma
    Kerry Logo
    Kerry
    KLK Oleo
    KLK Oleo
    Lipoid
    Lubrizol Life Science Health
    Lubrizol Life Science Health
    MAGNESIA
    MAGNESIA
    MEGGLE Excipients & Technology
    MEGGLE
    Nagase Viita
    Nagase Viita
    Nordic Bioproducts
    Nordic Bioproducts
    Pfanstiehl
    Pfanstiehl
    pharm-a-spheres
    pharm-a-spheres
    PMC Isochem
    PMC Isochem
    Seppic
    Seppic
    ShinEtsu
    ShinEtsu
    Sigachi
    Sigachi
    SPI Pharma
    SPI Pharma
    Südzucker
    Südzucker
    Vikram Thermo
    Vikram Thermo
    Zerion Pharma
    Zerion Pharma
    • A-B
      • ADM
      • ARMOR PHARMA
      • Ceolus™ & Celphere™
      • Ashland
      • BASF
      • Beneo – galenIQ
      • Biogrund
      • Budenheim
    • C-G
      • Captisol
      • Croda
      • Cyclolab
      • DFE Pharma
      • DuPont Pharma Solutions
      • Evonik
      • Fuji Chemical Industries
      • Gattefossé
      • Gangwal Healthcare
    • I-O
      • ingredientpharm
      • IOI Oleochemical
      • JRS Pharma
      • Kerry
      • KLK Oleo Life Science
      • Lactalis Ingredients Pharma
      • Lipoid
      • Dr. Paul Lohmann
      • Lubrizol
      • Magnesia
      • MEGGLE Excipients
      • Nagase Viita – Pharmaceutical Ingredients
      • Nordic Bioproducts Group
    • P-Z
      • Pfanstiehl
      • pharm-a-spheres
      • Pharma Line
      • PMC Isochem
      • Roquette Pharma
      • Seppic
      • Shin-Etsu
      • Sigachi Group
      • Südzucker AG
      • VIKRAM THERMO
      • Zerion Pharma
      • ZoomLab® – Your Virtual Pharma Assistant
  • Inquiries
    • Product Inquiry
    • Tailored Tableting Excipients
      • Tailored Film Coating
  • Events
    • Overview Pharmaceutical Webinars
    • Videos CPhI Frankfurt 2025
    • CPhI China 2024
    • ExciPerience – The great excipient event!
  • All4Nutra
No Result
View All Result
Pharma Excipients
No Result
View All Result

Startseite » News » Oral delivery of stabilized lipid nanoparticles for nucleic acid therapeutics

Oral delivery of stabilized lipid nanoparticles for nucleic acid therapeutics

3. November 2024
Oral delivery of stabilized lipid nanoparticles for nucleic acid therapeutics

Oral delivery of stabilized lipid nanoparticles for nucleic acid therapeutics

Abstract

Gastrointestinal disorders originate in the gastrointestinal tract (GIT), and the therapies can benefit from direct access to the GIT achievable through the oral route. RNA molecules show great promise therapeutically but are highly susceptible to degradation and often require a carrier for cytoplasmic access. Lipid nanoparticles (LNPs) are clinically proven drug-delivery agents, primarily administered parenterally. An ideal Orally Delivered (OrD) LNP formulation should overcome the diverse GI environment, successfully delivering the drug to the site of action. A versatile OrD LNP formulation has been developed to encapsulate and deliver siRNA and mRNA in this paper. The formulations were prepared by the systematic addition of cationic lipid to the base LNP formulation, keeping the total of cationic lipid and ionizable lipid to 50 mol%. Biorelevant media stability depicted increased resistance to bile salt mediated destabilization upon the addition of the cationic lipid, however the in vitro efficacy data underscored the importance of the ionizable lipid. Based on this, OrD LNP was selected comprising of 20% cationic lipid and 30% ionizable lipid. Further investigation revealed the enhanced efficacy of OrD LNP in vitro after incubation in different dilutions of fasted gastric, fasted intestinal media, and mucin. Confocal imaging and flow cytometry confirmed uptake while in vivo studies demonstrated efficacy with siRNA and mRNA as payloads. Taken together, this research introduces OrD LNP to deliver nucleic acid locally to the GIT.

Introduction

Drug delivery vehicles bolster the therapeutic prowess of nucleic acid payloads. They offer protection to enzymes and other degradants, improve the half-life of the payload, and modulate the biodistribution, offering tissue and cell-specificity. Almost all the nucleic acids that have been translated into the clinic are administered parenterally through infusions or injections [1]. This approach is logical within the drug development process, particularly when establishing proof of concept or introducing novel modalities and mechanisms of action. Patient-centric considerations, along with other formulation attributes such as extended shelf-life, are typically prioritized only after safety and efficacy benchmarks have been achieved. Gastrointestinal (GI) ailments have origins in the GI tract (GIT), such as Eosinophilic Esophagitis in the esophagus [2], Gastroparesis in the stomach [3], Celiac disease in the small intestine [4], colorectal cancer in the colon [5] and IBD manifests itself differently through the GI tract with ulcerative colitis localized in the colon, and Crohn’s disease affecting the entire GIT [6]. Furthermore, any off-target effects of the therapy can be circumvented if administered locally. This accentuates the necessity for site-specific therapeutic approaches to gastrointestinal maladies. Consequently, it is unsurprising that the oral administration of macromolecules represents the quintessential objective that drug delivery scientists endeavor to realize. Oral delivery offers high patient compliance and lowers the burden on hospitals. The successful localized delivery of potent molecules offers targeted relief and reduces off-target effects. Furthermore, the GIT offers access to a wide variety of immune cells, providing a lucrative target for immune-modulatory therapies. Lastly, the vascularized nature of the GIT, provides access to systemic delivery of the payload.

Nucleic acids are extremely labile, and susceptible to degradation via nucleases abundant in the GIT [7]. Nucleic acids need to be protected for their safe transit from the oral route to the cytoplasm of GI cells. Nanoparticles have been evaluated for oral delivery of nucleic acids, generally are made up of polymers of natural proteins and carbohydrates [8,9,10]. Out of all the polymeric systems, hybrid systems can particularly provide multiple levels of protection and retain the integrity of the payload through the GIT. Successful polymeric hybrid systems used for oral delivery of nucleic acids include the nanoparticle in microsphere (NiMOS) that protects and delivers the nucleic acid locally. NiMOS are composed of multiple gelatin nanoparticles (GNPs) with encapsulated nucleic acid which are encased within a protective microparticle made up of a polymer such as poly(epsilon-caprolactone) (PCL) [11]. PCL protects the GNPs in the stomach, and degrades in response to the lipases and proteases present in the small and large intestines [11]. NiMOS deliver the payload locally and do not get systemically absorbed as was shown by In(111)-labeled GNPs [12], and have been shown to be more effective in transfecting luminal enterocytes [13]. NiMOS are versatile, having shown to alleviate inflammation with various payloads such as IL-10 pDNA in TNBS induced colitis model [13], with siTNFα and siCyD1 in DSS induced acute colitis model [14, 15], and siIL15 and siTG2 in Poly(I:C) model of celiac disease [16, 17]. NiMOS are prime example of designing orally delivered nucleic acid systems keeping the GI physiology in mind.

While valuable insights can be drawn from the use of polymeric vehicles, the success of orally administered LNPs has thus far been constrained. LNPs are the most potent form of nucleic acid transfection agents that have demonstrated clinical success. Major efforts have been made to improve their potency when administered parenterally. Typical LNP formulations that were originally developed for parenteral administration when used for oral delivery was met with varying degrees of success [18, 19]. Ball et al. explored the stability of their LNP formulation, 306O13 Lipidoid, under various gastrointestinal tract (GIT) conditions. The formulation comprised 306O13 Lipidoid: DSPC: Chol: PEG(2 k) = 50: 10: 38.5: 1.5 (mol%), with a mass ratio of ionizable lipid to siRNA at 5:1. It maintained encapsulation across a pH range from 2 to 7. However, challenges arose when pepsin led to aggregation and bile salts reduced its in vitro efficacy. Additionally, the encapsulated Cy5.5 labeled siRNA showed a very low signal, which might be attributed to either the low dose of 0.5 mg/kg or the label detaching from the siRNA. The study also noted that siGAPDH did not exhibit efficacy compared to untreated controls, and rectal LNP delivery at 5 mg/kg highlighted some limitations of the formulation in achieving successful transfection. In another study, El-Mayta et al. utilize barcode DNA encapsulated LNP composed of C12-200: DSPC: Chol: PEG (1 k) = 40:10:30:20 (mol%), with a mass ratio of ionizable lipid to barcode DNA of 10: 1. This LNP accumulated the most in the small intestine and the colon. While this study utilizes DNA as the payload and deep sequencing to depict accumulation, efficacy would be predicated on the successful protein production which this study does not particularly evaluate. As such these studies illustrate some limitations and urge further investigation into formulation development to balance GIT stability and efficacy.

In the current research, our main aim was to develop an oral LNP platform that can deliver a variety of nucleic acid payloads. We chose C12-200 as the ionizable lipid since it lacks hydrolysable bonds and has demonstrated high transfection efficiency for siRNA as well as mRNA delivery [20, 21]. Additionally, DOTMA (N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride) was selected as permanently charged cationic lipid to increase the core positive charge for better nucleic acid complexation, which would impart increased stability as LNP traverses through the GIT. We demonstrated that addition of DOTMA to the C12-200 LNPs improved stability in biorelevant media and exhibited efficacy with siRNA (or mRNA) in vitro as well as in vivo. The incorporation of 20% DOTMA into the formulation completed the makeup of components for our candidate orally delivered (OrD) LNP. Our results validate OrD LNPs as a platform technology for delivery of variety of nucleic acid payloads with potential for rapid clinical translation to the clinic.

Download the full article as PDF here Oral delivery of stabilized lipid nanoparticles for nucleic acid therapeutics

or read it here

Materials

Lipid C12-200 (CAS: 1,220,890–25-4) was obtained from Corden Pharma, Switzerland. 1,2-di-O-octadecenyl-3-trimethylammonium propane (chloride salt) (DOTMA, 890,898), Distearoylphosphatidylcholine (DSPC, 850,365), Cholesterol (Chol, 700000P), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000]-N-(Cyanine 5) DSPE PEG(2000)-N-Cy5 (Cy5 PEG, 810,891), and 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG(2 k), 880151P) were obtained from Avanti Polar Lipids, Alabama. Fasted State Simulated Gastric Fluid (FaSSGF), Fasted State Simulated Intestinal Fluid (FaSSIF), and Fed Sate Stimulated Intestinal Fluid was prepared using 3F Powder ™ (Biorelevant©, FFF02) and FaSSGF Buffer concentrate (Biorelevant©, FASGBUF), FaSSIF Buffer Concentrate (Biorelevant©, FASBUF), and FeSSIF Buffer Concentrate (Biorelevant©, FESBUF), respectively. Sodium Taurcholate (CAS: 145–42-6) was purchased from Spectrum ®. siRNA against Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), siGAPDH (Invitrogen™, Silencer™, AM4632), Cy-3 labeled siGAPDH (Invitrogen™, Silencer™, AM4640), and negative control siRNA (siNeg, Invitrogen™, Silencer™ Select Negative Control No. 1 siRNA, 4,390,843) was obtained from ThermoFisher Scientific. siRNA against Hypoxanthine–guanine phosophoribosyltransferase (HPRT), siHPRT was obtained from Takeda Pharmaceuticals had the sequence (Sense strand: GCCAGACUUUGUUGGAUUUGA, anti-sense strand: UCAAAUCCAACAAAGUCUGGCUU). CleanCap®Firefly Luciferase mRNA (5-methoxyuridine) was obtained TriLink™ (FLuc mRNA, L-7202). Quant-it™ Ribogreen RNA Assay kit (Invitrogen™, R11490), TaqMan™ Fast Advanced Cells-to-CT™ Kit (Invitrogen™, A35374), KDalert™ GAPDH Assay Kit (Invitrogen™, AM1639), Pierce™ BCA Protein Assay Kit (Thermo Scientific™, 23,227), PureLink™ RNA Mini Kit (Invitrogen™, 12,183,025), High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, 4,368,814), TaqMan™ Gene Expression Master Mix (Applied Biosystems™, 4,369,542), HPRT Taqman primer (Mm03024075_m1), Peptidyl-prolyl cis–trans isomerase B (PPIB) Taqman primer (Mm00478295_m1) and GAPDH Taqman primer (Mm99999915_g1) was obtained from ThermoFisher Scientific. Dulbecco’s Modified Eagle Medium (DMEM, 11,965,118), Cell Dissociation reagent (Gibco™, TrypLE™ Express Enzyme (1X), phenol red, 12,605,010), 0.25% Trypsin–EDTA (Gibco™, 25,200,056), penicillin/streptomyocin (Gibco™, 15,070,063), Opti-MEM™ Reduced Serum media (OMEM, Gibco™, 31,985,062), and Phosphate Buffered Saline (PBS, pH 7.4, Gibco™, 10,010,023) were purchased from Life Technologies. Fetal Bovine Serum (FBS, Sigma-Aldrich ™, 12103C-100ML), Mucin from porcine stomach (Sigma-Aldrich®, M2378-100G) was obtained from Millipore Sigma. CellTiter-Fluor™ Cell Viability Assay (G6081), ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay (E7120), was obtained from Promega Corporation.

Suri, K., Pfeifer, L., Cvet, D. et al. Oral delivery of stabilized lipid nanoparticles for nucleic acid therapeutics. Drug Deliv. and Transl. Res. (2024). https://doi.org/10.1007/s13346-024-01709-4


Read also our introduction article on Orally Disintegrating Tablets (ODTs) here:

Orally Disintegrating Tablets (ODTs)
Orally Disintegrating Tablets (ODTs)
Tags: excipientsformulation

Related Posts

Predicting disintegration time in fast-disintegrating tablets using machine learning a data-driven framework based on functional excipient representation
Disintegrant / Superdisintergrant

Predicting disintegration time in fast-disintegrating tablets using machine learning: a data-driven framework based on functional excipient representation

24. April 2026
Workflow of AI modeling.
Artificial Intelligence

Application of AI in Tablet Development: An Integrated Machine Learning Framework for Pre-Formulation Property Prediction

24. April 2026
Hydroxypropyl Methylcellulose Capsules Enhance Aerodynamic Performance of Carrier-Based Dry Powder Inhaler Formulations A Comprehensive Evaluation of Capsule Material Effects
Capsugel

Hydroxypropyl Methylcellulose Capsules Enhance Aerodynamic Performance of Carrier-Based Dry Powder Inhaler Formulations: A Comprehensive Evaluation of Capsule Material Effects

23. April 2026
Next Post
An Exploration of Dissolution Tests for Inhalation Aerosols

An Exploration of Dissolution Tests for Inhalation Aerosols

Cart

Shop Search

  • Search for excipients and samples
  • Product Inquiry
  • Newsletter Registration
  • Visit the Homepage

Top Pharma-Excipient Links

  • Pharmaceutical Excipients – Some Definition
  • Inactive ingredient search for approved drug products in the USA
  • Excipient Suppliers List
  • GRAS Substances (SCOGS) Database
  • DC Excipients List
  • Homepage

About | Privacy Policy | Cookie policy | Cookie Settings | Contact | Homepage
Copyright: PharmaExcipients AG

Welcome Back!

Login to your account below

Forgotten Password?

Retrieve your password

Please enter your username or email address to reset your password.

Log In
No Result
View All Result
  • Shop
  • News
    • Specials
      • Excipients for CBD
      • Excipients & 3D Printing
      • Infographics – The overview
      • GMP-certified excipient production sites
      • The Future of TiO2
      • Excipients in the COVID-19 Vaccines
      • BASF PVP-Iodine
      • RegXcellence™
      • BASF Parenteral Excipients
    • World Days – The overview
  • Excipient basics
    • Excipient Solutions for CBD
    • Inorganic Chemicals
      • Calcium Carbonate
      • Calcium Phosphates
      • Calcium Sulfate
      • Halites
      • Metallic Oxides
      • Silica
    • Organic Chemicals
      • Actual Sugars
      • Artificial Sweeteners
      • Carbohydrates
      • Cellulose
      • Cellulose Esters
      • Cellulose Ethers
      • CMC and Croscarmellose Sodium
      • Converted Starch
      • Dried Starch
      • Microcrystalline Cellulose
      • Modified Starch
      • Starch
      • Sugars
      • Sugar Alcohols
    • Petrochemicals
      • Acrylic Polymers
      • Glycols
      • Mineral Hydrocarbons
      • Mineral Oils
      • Mineral Waxes
      • Petrolatum
      • Polyethylene Glycol (PEG)
      • Povidones
      • Propylene Glycol
      • Other Petrochemical Excipients
    • Oleochemicals
      • Fatty Alcohols
      • Glycerin
      • Mineral Stearates
      • Pharmaceutical Oils
      • Other Oleochemical Excipients
    • Proteins
  • Applications
    • 3D Printing – Drug Carrier
      • 3D Printing
      • Binder
      • Coating
      • Colour / Color
      • Coating Systems and Additives
      • Controlled Release Excipient
      • DC excipient
      • Disintegrant / Superdisintergrant
      • Drug Carrier
    • Emulsifier – Glidant
      • Emulsifier
      • Excipient for Inhalation
      • Filler
      • Film former
      • Flavour / Flavor
      • Glidant
    • Lubricant – Preservative
      • Lubricant
      • Nanotechnology
      • Orally Dissolving Technology Excipient
      • Pellet
      • Plasticizer
      • Preservative
    • Solubilizer – Viscocity Agent
      • Solubilizer
      • Speciality Excipient
      • Surfactants
      • Suspension Agent
      • Sustained Release Agent
      • Sweeteners
      • Taste Masking
      • Topical Excipient
      • Viscocity Agent
  • Sources
    • Handbook of Pharmaceutical Excipients – 9th Edition
    • EINECS Numbers
    • Excipient DMF List
    • Excipient cGMP Certification Organisations
    • FDA Inactive Ingredient List
    • FDA GRAS Substances (SCOGS) Database
    • Excipient E-Numbers
    • Whitepapers / Publications
    • Contract Development|Contract Manufacturing
  • Suppliers
    • A-B
      • ADM
      • ARMOR PHARMA
      • Ceolus™ & Celphere™
      • Ashland
      • BASF
      • Beneo – galenIQ
      • Biogrund
      • Budenheim
    • C-G
      • Captisol
      • Croda
      • Cyclolab
      • DFE Pharma
      • DuPont Pharma Solutions
      • Evonik
      • Fuji Chemical Industries
      • Gattefossé
      • Gangwal Healthcare
    • I-O
      • ingredientpharm
      • IOI Oleochemical
      • JRS Pharma
      • Kerry
      • KLK Oleo Life Science
      • Lactalis Ingredients Pharma
      • Lipoid
      • Dr. Paul Lohmann
      • Lubrizol
      • Magnesia
      • MEGGLE Excipients
      • Nagase Viita – Pharmaceutical Ingredients
      • Nordic Bioproducts Group
    • P-Z
      • Pfanstiehl
      • pharm-a-spheres
      • Pharma Line
      • PMC Isochem
      • Roquette Pharma
      • Seppic
      • Shin-Etsu
      • Sigachi Group
      • Südzucker AG
      • VIKRAM THERMO
      • Zerion Pharma
      • ZoomLab® – Your Virtual Pharma Assistant
  • Inquiries
    • Product Inquiry
    • Tailored Tableting Excipients
      • Tailored Film Coating
  • Events
    • Overview Pharmaceutical Webinars
    • Videos CPhI Frankfurt 2025
    • CPhI China 2024
    • ExciPerience – The great excipient event!
  • All4Nutra

About | Privacy Policy | Cookie policy | Cookie Settings | Contact | Homepage
Copyright: PharmaExcipients AG