Optimized lipid nanoparticles for pulmonary delivery of CRISPR/Cas9 targeting KRAS G12S in lung cancer

Abstract

KRAS G12S mutations in non-small cell lung cancer (NSCLC) remain refractory to current targeted therapies, with few clinical options and frequent resistance. While CRISPR/Cas9 enables mutation-specific gene disruption, its pulmonary application is limited by systemic clearance, hepatic tropism, and airway mucus barriers. Here, we present lipid nanoparticles (LNPs) specifically engineered for pulmonary delivery of Cas9 mRNA and KRAS G12S-targeting sgRNA, optimized through mRNA surrogate screening and orthogonal mixture design to guide lipid composition and Cas9:sgRNA weight-to-weight ratios. Two lead LNP formulations, A6 3:1 and A8 1:1, exhibited robust critical quality attributes, including particle sizes below 120 nm, low polydispersity, near-neutral zeta potential, and over 80 % encapsulation efficiency. Cryo-TEM revealed distinct morphologies correlated with enhanced transfection. In vitro, A8 1:1 achieved up to 90 % on-target gene editing in A549 cells and a 3.6-fold increase in apoptosis, while A6 3:1 induced a 3.7-fold apoptotic response. Both formulations efficiently traversed airway mucus in air-liquid interface cultures and preserved over 80 % cell viability across doses. In vivo, repeated pulmonary administration was well tolerated, with no signs of systemic toxicity or cytokine elevation in healthy or tumor-bearing mice. In an orthotopic A549-luc lung tumor model, intratracheal delivery of A6 3:1 and A8 1:1 modestly suppressed tumor growth, with histological evidence of tumor cell apoptosis for A8 1:1. Quantification confirmed a statistically significant increase of apoptosis in the A8 1:1 group, consistent with effective KRAS disruption in vivo. Overall, lead LNPs, particularly A8 1:1, enabled efficient and localized RNA-based gene editing that induced downstream apoptotic signaling, demonstrating a preliminary, yet promising, proof-of-concept for CRISPR/Cas9 therapy in NSCLC.

Introduction

Lung cancer ranks among the most prevalent malignancies, accounting for nearly 1.8 million deaths worldwide in 2020, which corresponds to approximately 20 % of all cancer-related mortality [1]. Oncogenic driver mutations in genes such as epidermal growth factor receptor (EGFR), anaplastic lymphoma kinase (ALK), and ERBB2 [2] are well-documented. Yet, mutations in the KRAS oncogene are the most frequent and present in about 25 % of all non-small cell lung cancer (NSCLC) cases, with the G12C point mutation being the most common [3]. While therapies for EGFR or ALK mutations have significantly improved patient outcomes, targeted therapies for KRAS mutations have historically been limited [4,5]. The approval of two KRAS G12C-specific inhibitors for the treatment of NSCLC, namely Sotorasib and Adagrasib, by the U.S. Food and Drug Administration (FDA) represents a major therapeutic advance. These covalent inhibitors selectively bind to the cysteine residue at position 12 within the switch II pocket of the GDP-bound KRAS protein, locking it in an inactive state and preventing downstream oncogenic signaling [6,7]. Despite their clinical efficacy, these therapies are limited to patients harboring the G12C mutation and are typically administered after prior systemic therapy, leaving the majority of KRAS-mutated cases without selective treatment [3,6,7]. Moreover, the reliance on a unique amino acid for inhibition is associated with susceptibility to acquired resistance, observed in nearly half of treated patients [8]. Common resistances include secondary KRAS mutations (e.g., G12D, G13D, G12S), alterations in the drug binding-pocket (e.g., Y96C), bypass signaling via MET, NRAS, BRAF, or RET, and histologic transformation [[8], [9], [10]]. Given these challenges, there is a clear need for broader and more durable therapeutic strategies capable of overcoming resistance and targeting a wider spectrum of KRAS mutations.

Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9, originally part of the bacterial immune system against phages, has become a powerful and versatile genome-editing tool. When paired with a single guide RNA (sgRNA), the complex can selectively bind to target DNA sequences and induce site-specific double-strand breaks [11,12]. These breaks are primarily repaired by non-homologous end joining (NHEJ), a process that directly ligates the DNA ends but is prone to errors. As a result, insertions or deletions (indels) frequently occur [13], often disrupting the coding sequence and leading to loss of protein function [14]. This mechanism can be used to selectively disrupt mutated KRAS and suppress further tumor growth. Moreover, the system allows for rapid adaptation. The emergence of novel or uncommon mutations can be readily addressed by redesigning the sgRNA.

Despite the therapeutic promise of CRISPR/Cas9 for the treatment of NSCLC, efficient delivery remains challenging. CRISPR/Cas9 delivery can be achieved through several strategies: (i) direct delivery of the Cas9/sgRNA ribonucleoprotein complex, in which the Cas9 protein is pre-assembled with the sgRNA prior to administration, (ii) plasmid DNA encoding both Cas9 and the sgRNA, or (iii) mRNA encoding Cas9 in combination with a separate sgRNA [15]. Direct cellular uptake of proteins is inherently inefficient, and their purification is both technically demanding and cost-intensive [15,16]. An attractive alternative is the use of mRNA encoding Cas9, which enables transient protein expression and, thereby, minimizes the risk of off-target genome editing. Unlike plasmid DNA, mRNA does not integrate into the host genome and can undergo multiple rounds of translation, enhancing indel formation while requiring less input material. Additionally, mRNA is generally less immunogenic than plasmid DNA or the Cas9 protein, making it more suitable for therapeutic applications [17].

Lipid nanoparticles (LNPs) have transformed nucleic acid delivery by protecting mRNA from degradation and enabling efficient cell uptake and cytoplasmic release [[18], [19], [20]]. This technology has been successfully applied to deliver CRISPR/Cas9 components, demonstrating therapeutic efficacy in preclinical models, including the suppression of VEGFR2-expressing lung tumors in mice [21]. The recent FDA approval of Casgevy®, the first CRISPR/Cas9-based therapy for sickle cell disease and beta-thalassemia, further validates the clinical potential of genome editing technologies [22]. Extending these breakthroughs, LNP-mediated delivery of CRISPR/Cas9 is now being explored through clinical trials across a broad spectrum of indications, including metabolic, immunological, and cardiovascular diseases [[23], [24], [25]].

The success of mRNA vaccines against COVID-19 has demonstrated the safety, scalability, and clinical impact of LNP platforms, establishing them as suitable vehicles for RNA therapeutics, including Cas9 mRNA and sgRNA [18,19]. Both research-grade and FDA-approved formulations rely on lipid compositions originally introduced in Onpattro® [26], the first siRNA-based drug approved for hereditary transthyretin-mediated amyloidosis. Onpattro’s formulation was optimized for hepatic delivery [27], taking advantage of the natural tropism of LNPs for hepatocytes via apolipoprotein E-mediated uptake. While highly effective for liver-targeted therapies, this intrinsic hepatic tropism presents a major barrier for pulmonary applications such as lung cancer.

This limitation is particularly critical in lung-targeted therapies, where systemic administration fails to engage the epithelial compartment. Instead of reaching the airway epithelium, intravenously delivered LNPs accumulate in the pulmonary vasculature, leading to capillary entrapment and thrombus formation, as previously demonstrated [28]. These findings reveal a key limitation of conventional delivery routes and emphasize the need to circumvent vascular barriers. Pulmonary administration via intratracheal or aerosolized delivery offers a transformative alternative by enabling direct epithelial deposition, minimizing off-target accumulation, and maximizing the therapeutic efficacy of RNA-based interventions for respiratory diseases [29]. Moreover, the lung’s vast surface area, thin epithelial barrier, and rich vascularization create a uniquely permissive environment for rapid uptake and localized action, making it an ideal gateway for gene editing, immunomodulation, and regenerative therapies [30].

To address the unmet clinical need in KRAS G12S-driven lung cancer, this study aims to employ a rational optimization strategy to refine LNP formulations for efficient pulmonary delivery of CRISPR/Cas9. Downstream functional effects, including apoptosis, were evaluated as indicators of targeted gene disruption in the lung. We first screened lipid molar ratios to identify compositions that maximize mRNA delivery efficiency. These were further refined by optimizing the weight-to-weight (w/w) ratios of Cas9 mRNA and sgRNA to enhance gene editing performance. Each formulation underwent thorough physicochemical characterization, including particle size, polydispersity index (PDI), zeta potential, and encapsulation efficiency, and was evaluated in vitro for KRAS G12S gene editing, downstream signaling disruption, and transport performance under mucin-producing conditions mucus. Finally, the most promising candidates were assessed in vivo via pulmonary administration, where they demonstrated favorable tolerability and effective apoptosis induction. This proof-of-concept study establishes its potential as a non-invasive therapeutic strategy for KRAS-driven lung cancer.

Download the full article as PDF here Optimized lipid nanoparticles for pulmonary delivery of CRISPR/Cas9 targeting KRAS G12S in lung cancer

or continue reading here

Materials

The ionizable lipid 1-octylnonyl 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]octanoate (SM-102) was purchased from MedChemExpress (New Jersey, USA), while cholesterol, (1,2-distearoyl-sn glycero-3-phosphocholine (DSPC)), and (1,2 dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000)) were obtained from Sigma-Aldrich (Taufkirchen, Germany). CleanCap® Cas9 mRNA (5 moU) was bought from TriLink Biotechnologies (California, USA). Enhanced green fluorescent protein (eGFP) mRNA and Alexa Fluor 647-labeled eGFP mRNA were acquired from Ribopro (Maastricht, Netherlands). Vivaspin 6 columns (10 kDa MWCO) were purchased from Cytiva (Marlborough, USA). DNeasy blood & tissue kit was bought from QIAGEN (Venlo, Netherlands). Propidium Iodide solution and the LEGENDplex™ MU Th Cytokine Panel were purchased from BioLegend (San Diego, USA). The TUNEL Assay Kit – HRP-DAB was acquired from Abcam (Cambridge, United Kingdom). Droplet generation oil, ddPCR supermix for probes, ddPCR primers G12S NEHJ, DG8™ cartridges, and gaskets were obtained from Bio-Rad (California, USA). PCR primers (F: TTTGAGAGCCTTTAGCCGC, R: TCTACCCTCTCACGAAACTC) and primers for Sanger sequencing (F: TCTTAAGCGTCGATGGAG, R: ACAGAGAGTGAACATCATGG) were purchased from Sigma-Aldrich (Taufkirchen, Germany). Dulbecco’s Phosphate Buffered Saline (PBS), Fetal Bovine Serum (FBS), KRAS G12S sgRNA (5′- CUUGUGGUAGUUGGAGCUAG-3′), Pur-A-Lyzer™ Maxi 3500 molecular weight cut-off (MWCO), RPMI-1640, sodium acetate, 100× Tris-EDTA buffer solution, cell counting kit 8 (CCK-8), Dulbecco’s Modified Eagle Medium (DMEM) high glucose medium, Eagle’s MEM, MEM non-essential amino acid solution (NEAA), and Triton™ X-100 were purchased from Sigma-Aldrich (Taufkirchen, Germany). PBS 10×, absolute ethanol molecular biology grade, Gibco™ Opti-MEM™ reduced serum, Gibco™ Penicillin-Streptomycin (P/S), Quant-it™ RiboGreen RNA reagent, Annexin V-AF488, Phusion Green Hot Start II High-Fidelity PCR Mastermix, ExoSAP-IT Express PCR Product Cleanup Reagent, Lipofectamine 2000, GeneRuler 1 kb Plus DNA Ladder, and trypsin-EDTA (0.05 %) phenol red were purchased from Thermo Fisher Scientific (Darmstadt, Germany).

Moritz Marschhofer, Siyu Chen, Müge Molbay, Benjamin Winkeljann, Ersilia Villano, Corinne Giancaspro, Alexandra Kourou, Otto Berninghausen, Susanne Rieder, Charlotte Ungewickell, Roland Beckmann, Bastian Popper, Ana Maria Torres, Anxo Vidal, Olivia M. Merkel, Simone P. Carneiro, Optimized lipid nanoparticles for pulmonary delivery of CRISPR/Cas9 targeting KRAS G12S in lung cancer, Journal of Controlled Release, Volume 391, 2026, 114607, ISSN 0168-3659, https://doi.org/10.1016/j.jconrel.2026.114607.

Read more on World Cancer Day 2026 here: