Uncovering the lymphatic uptake, pharmacokinetics, and biodistribution of mRNA-lipid nanoparticles after intravenous and subcutaneous injection

Abstract

Lipid nanoparticle (LNP) formulations have enabled the in vivo delivery of messenger ribonucleic acid (mRNA) vaccines and therapeutics yet the delivery of RNA remains relatively inefficient. In order to improve LNP design there is a need to better understand how current mRNA-LNP formulations are trafficked and expressed in vivo. Importantly, no prior work has quantified mRNA-LNP transport through lymphatics. In the current study we profile the thoracic lymph uptake, plasma pharmacokinetics (PK), and tissue protein expression after intravenous (IV) and subcutaneous (SC) administration in rats of three common LNP formulations (ALC-0315, SM-102 and MC3 ionizable lipids) containing muGFP-P2A-nLuc reporter mRNA. After IV administration, the SM-102 and MC3 LNP formulations provided the most effective protection of mRNA in plasma. Despite this, tissue NanoLuc® Luciferase (nLuc) expression at 32 h post-dosing was relatively similar across formulations with highest expression seen in the liver and spleen.

After SC injection, all formulations supported relatively low bioavailability of mRNA (0.42–0.87% dose) and slightly higher bioavailability of ionizable and PEG lipid (<5% dose) with PK profiles of the ionizable lipid and PEG lipid not completely matching the mRNA PK profiles. There was also greater lymphatic recovery of all ionizable lipids (3.1–4.3% dose) compared to mRNA (0.62–1.4% dose) and PEG lipid (1.9–2.0% dose). Together these data suggest that mRNA is lost prior to or during lymphatic transport. Importantly, concentrations of all mRNA-LNP components were 10–1000 fold higher in thoracic lymph compared to plasma after SC injection. At 32 h after SC injection, highest nLuc expression was seen in lymph nodes and tissues near the dosing site and in the liver and spleen. These findings demonstrating that mRNA-LNPs predominantly traffic from tissue injection sites via lymphatics, mRNA-LNP components may traffic separately from each other in both lymph and blood, and tissue protein expression reflects the PK of mRNA-LNPs at early timepoints.

Introduction

Messenger ribonucleic acid (mRNA) has versatile applications in medicine from vaccination [1], [2] to protein replacement and supplementation therapy [3], [4], [5], pluripotent stem cell induction [6], [7] and gene editing [8], [9]. Most of these applications were not possible until the past two decades due to our inability to effectively delivery mRNA to cells within the body [10], [11]. mRNA delivery is challenging due to the poor stability of mRNA in biological environments and poor uptake of mRNA into cells due to its large size and net negative charge [10], [11]. These significant delivery challenges have been partially overcome through encapsulation of mRNA into nanoparticle delivery systems, with lipid nanoparticles (LNPs) being most widely used [10], [11].

LNPs are employed in marketed RNA products such as the Moderna and Pfizer/BioNTech COVID-19 mRNA vaccines [1], [2] and Patisiran, a siRNA product for the treatment of hereditary transthyretin amyloidosis [12]. These marketed LNP products are administered via intramuscular (IM) or intravenous (IV) injection and result in protein expression predominantly at the injection site and in the liver [1], [2]. Subcutaneous (SC) injection of mRNA-LNP products is increasingly of interest due to the convenience of SC injection for self-administration for chronic treatments [13], [14], [15]. Indeed, several SC administered mRNA-LNP formulations have been tested in clinical trials [13], [16].

LNPs are quite complex particles composed of mRNA and four lipid components – the ionizable lipid, cholesterol, helper lipid (phospholipid) and polyethylene glycol (PEG) lipid [10], [11]. LNPs differ to a liposome in that liposomes have a hollow fluid filled core whereas LNPs are filled with lipid [10], [11]. The ionizable lipid enhances cellular uptake and endosomal escape as it becomes ionised at the acidic pH in the endosome which is proposed to disrupt the endosome membrane [10], [11]. The cholesterol, helper lipid and PEG lipid impart stability to LNPs with the PEG lipid also extending circulation time in the body by reducing rapid uptake and clearance of the LNP by phagocytic cells [10], [17], [18].

The biodistribution of mRNA-LNP medicines and vaccines to cells, tissues, lymph and blood compartments are critical determinants of efficacy and safety [5]. Importantly, the pharmacokinetics (PK) and biodistribution of mRNA-LNP medicines and vaccines is far more complex than a small-molecule drug as each component of the mRNA and LNP complex may undergo absorption, distribution, metabolism and/or excretion (ADME) and cell uptake differentially [5], [10], [11]. It is thus necessary to track each component to fully understand how each component of the system is absorbed, distributed and cleared. Additionally, the expressed protein, but not the mRNA-LNP components, are biologically active such that the cellular uptake, endosomal escape, efficiency and kinetics of protein expression and protein elimination are all relevant to the ultimate therapeutic and off-target effects of the mRNA-LNP product [5], [10], [11]. These steps differ across tissues and cell types [14] and are relatively inefficient with only <10% of mRNA-LNP escaping the endosome and < 1% of the dosed mRNA being expressed into a protein [19].

Importantly, we still lack complete understanding of the factors that control mRNA-LNP PK, biodistribution and protein expression. Intriguingly, several papers have reported discrepancies in the PK of the mRNA cargo and lipid components of LNP where the plasma concentrations over time and plasma elimination half-lives do not match [4], [14]. In some cases, the mRNA persists for longer than the lipid [4], [14]. This raises interesting questions regarding for how long the LNP lipid and mRNA components remain together and where they separate. The mRNA-LNP is certainly remodelled over time in biological fluids, with PEG lipids prone to shedding off the mRNA-LNP in plasma [4], [14], [20], [21]. The mRNA-LNP also gains a coating of endogenous proteins and lipids called the ‘corona’ that might alter LNP PK, biodistribution, cellular uptake and protein expression [10], [20], [22].

Following injection into tissues, mRNA-LNPs might be expected to distribute into the lymphatics due to their size (typically 50–100 nm in diameter) since prior studies have shown that other nanoparticles of 10–100 nm diameter are predominantly transported from tissues via lymphatics [23], [24], [25]. This is because the lymphatic capillaries in tissues have open-button like junctions that enable entry of macromolecules and nanoparticles [25], [26], [27]. Lymphatic capillaries flow into collecting lymphatic vessels then downstream lymph nodes that are rich in immune cells [25], [27]. This pathway of trafficking of mRNA-LNP vaccines and immunotherapies will thus enable adaptive immune responses [10], [25]. Transport through lymph is also expected to alter mRNA-LNP remodelling, protein and lipid corona, and thus to impact mRNA-LNP stability, tissue distribution and cellular uptake. Despite this, no previous study has directly quantified the trafficking of mRNA-LNP components through the lymphatics.

Understanding the fate of mRNA and LNP lipid components and expressed protein in the body is essential as this ultimately impacts the efficacy, safety, and dosing requirements for mRNA-LNP vaccines and therapeutics. Our aim was thus to quantitatively profile the plasma PK, lymphatic uptake, and biodistribution of mRNA, lipid and protein in rats following IV and SC administration of three common LNPs formulated with ALC-0315, SM-102 and MC3 ionizable lipids (mimicking the Pfizer and Moderna COVID vaccines [1], [2] and Patisiran [12] formulations, respectively) containing a reporter mRNA (muGFP-P2A-nLuc). Importantly, all assays were carefully validated and completely quantitative with expression of the NanoLuc® Luciferase (nLuc) in each tissue quantified against authentic standards and not measured via relative luminescence (as is almost exclusively reported in prior mRNA-LNP biodistribution studies).

We found that the LNP formulation significantly influence plasma PK and tissue biodistribution, with marked discrepancies between mRNA and lipid components in plasma and lymph PK indicative of remodelling of the mRNA-LNP even prior to entry into the blood circulation. Importantly, the mRNA concentrations in thoracic lymph were 10–1000-fold higher than in plasma after SC injection of all mRNA-LNPs, demonstrating that lymphatics are the major route of absorption for mRNA LNPs after injection into tissues. These findings provide important insights into the trafficking and tissue-specific protein expression of mRNA-LNPs that are directly relevant to their efficacy and safety, and can inform the design of mRNA-LNPs with more specific distribution profiles.

Download the full article as PDF here Uncovering the lymphatic uptake, pharmacokinetics, and biodistribution of mRNA-lipid nanoparticles after intravenous and subcutaneous injection

or continue reading here

Materials

The muGFP-P2A-nLuc mRNA was produced and assessed by the mRNA CORE at Monash Institute of Pharmaceutical Sciences, following the procedure described previously [14]. Heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-undecoxyhexyl)amino]octanoate (SM-102), [(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl] 4-(dimethylamino)butanoate (MC3), 6-[6-(2-hexyldecanoyloxy)hexyl-(4-hydroxybutyl)amino]hexyl 2-hexyldecanoate (ALC-0315), and 2-(2-methoxyethoxy)-N,N-di(tetradecyl)acetamide (ALC-0159) were purchased from DC Chemicals (Shanghai, China). [3-(2-methoxyethoxy)-2-tetradecanoyloxypropyl] tetradecanoate (DMG-PEG 2000), [3-[3-(2-methoxyethoxy)propylcarbamoyloxy]-2-tetradecanoyloxypropyl] tetradecanoate (C-DMG-PEG 2000), and [(2R)-2,3-di(octadecanoyloxy)propyl] 2-(trimethylazaniumyl)ethyl phosphate (DSPC) were obtained from Avanti Polar Lipids (Alabaster, USA). Cholesterol and Triton X-100 were sourced from Sigma-Aldrich (St. Louis, USA).

The Ignite cartridge was acquired from Precision NanoSystems (Vancouver, Canada), and the Pur-A-Lyzer Maxi Dialysis Kit was purchased from Merck (Darmstadt, Germany). The Amicon® Ultra centrifugal filter, 50 kDa MWCO was sourced from Merck (Darmstadt, Germany). The QuantiFluor RNA System, Glo Lysis Buffer, and the Nano-Glo® Luciferase Assay System Kit were purchased from Promega (Madison, USA). The Total RNA Purification Kit was acquired from Norgen Biotek (Thorold, Canada). The Luna® Universal One-Step RT-qPCR Kit was sourced from New England Biolabs (Ipswich, USA). Forward (GAGCTGTTCA) and reverse (GCGCTCGTCGATGATCTTGT) primers were purchased from Integrated DNA Technologies (IDT, Singapore). Kinetex® C8 column (2.6 μm particle size, 100 Å, 50 × 2.1 mm) was purchased from Phenomenex (Torrance, USA). Isopropyl alcohol, acetonitrile, and ethanol were of analytical purity or high-performance liquid chromatography (HPLC) grade from Merck (Bayswater, Victoria, Australia).

Peng Li, Mohammad Abdallah, Yuxin Yao, Rekha Shandre Mugan, Thomas J. Payne, Stewart A. Fabb, Colin W. Pouton, Natalie L. Trevaskis, Uncovering the lymphatic uptake, pharmacokinetics, and biodistribution of mRNA-lipid nanoparticles after intravenous and subcutaneous injection, Journal of Controlled Release, Volume 400, Part A, 2026, 115491, ISSN 0168-3659, https://doi.org/10.1016/j.jconrel.2026.115491.

Read more on Biopharma articles here:

• Amorphous trehalose as a superior lyoprotectant for high-temperature long-term storage of freeze-dried mRNA-lipid nanoparticles
• Colloidal protein stability and surface coverage by trehalose: bridging molecular dynamics and experimental work
• Ashland advances high-growth oral biologics delivery applications with launch of permexa™ sodium caprate